Stem-loop sequence hsa-mir-1254-1

AccessionMI0006388 (change log)
Previous IDshsa-mir-1254
Symbol HGNC:MIR1254-1
DescriptionHomo sapiens miR-1254-1 stem-loop
Gene family MIPF0000614; mir-1254
Stem-loop
   ggu  g      ---gc   -a      aa       cc       -a  ua 
5'    gg aggauu     uug  gccugg  gcuggag  ugcagug  ac  u
      || ||||||     |||  ||||||  |||||||  |||||||  ||  c
3'    cu uccuaa     aac  cggauc  cgaccuc  augucac  ug  a
   -au  g      aguaa   aa      --       --       cg  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1254

Accession MIMAT0005905
Sequence

18 - 

agccuggaagcuggagccugcagu

 - 41

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).