Stem-loop sequence hsa-mir-1253

AccessionMI0006387 (change log)
Symbol HGNC:MIR1253
DescriptionHomo sapiens miR-1253 stem-loop
Gene family MIPF0000611; mir-1253
Literature search

2 open access papers mention hsa-mir-1253
(3 sentences)

Stem-loop
   -a  --ag  a    ua      a    a a                gaug   a 
5'   gc    ca gaga  gaaucc aaag g agaagaucagccugca    ugg c
     ||    || ||||  |||||| |||| | ||||||||||||||||    |||  
3'   cg    gu uucu  cuuagg uuuc c ucuucuagucggacgu    auc u
   ac  aaga  a    --      g    c c                --aa   g 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 2748078-2748182 [-]
antisense
OTTHUMT00000438367 ; RAP1GAP2-003; intron 2
OTTHUMT00000438208 ; RAP1GAP2-001; intron 2
OTTHUMT00000438209 ; RAP1GAP2-002; intron 2
ENST00000540393 ; RAP1GAP2-003; intron 2
ENST00000254695 ; RAP1GAP2-001; intron 2
ENST00000366401 ; RAP1GAP2-002; intron 2
ENST00000542807 ; RAP1GAP2-201; intron 2
Database links

Mature sequence hsa-miR-1253

Accession MIMAT0005904
Sequence

24 - 

agagaagaagaucagccugca

 - 44

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).