Stem-loop sequence hsa-mir-1251

AccessionMI0006386 (change log)
Symbol HGNC:MIR1251
DescriptionHomo sapiens miR-1251 stem-loop
Gene family MIPF0000621; mir-1251
Literature search

5 open access papers mention hsa-mir-1251
(7 sentences)

Stem-loop
   -----  gg  u  a    cca         --c  c 
5'      gu  ac cu gcug   aaggcgcuu   uc u
        ||  || || ||||   |||||||||   || u
3'      ca  ug ga cgac   uuucgcgag   ag c
   cggua  ga  u  c    ucg         aca  u 
Get sequence
Deep sequencing
727 reads, 0 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 97491909-97491978 [+]
sense
OTTHUMT00000407381 ; RP11-541G9.1-001; intron 1
ENST00000552238 ; RP11-541G9.1-001; intron 1
Database links

Mature sequence hsa-miR-1251-5p

Accession MIMAT0005903
Sequence

5 - 

acucuagcugccaaaggcgcu

 - 25

Get sequence
Deep sequencing658 reads, 65 experiments
Evidence experimental; Illumina [1,3], cloned [2]
Predicted targets

Mature sequence hsa-miR-1251-3p

Accession MIMAT0026741
Sequence

43 - 

cgcuuugcucagccaguguag

 - 63

Get sequence
Deep sequencing42 reads, 22 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).