Stem-loop sequence hsa-mir-1250

AccessionMI0006385 (change log)
Symbol HGNC:MIR1250
DescriptionHomo sapiens miR-1250 stem-loop
Gene family MIPF0000696; mir-1250
Literature search

5 open access papers mention hsa-mir-1250
(5 sentences)

Stem-loop
   --    -c     ------   -    c    -  -c  u      ---          uugc 
5'   cugu  ccgcu      ggc cugg aggu ga  gg gcugga   uguggccuuu    c
     ||||  |||||      ||| |||| |||| ||  || ||||||   ||||||||||    u
3'   gaca  gguga      ccg gacc ucca cu  cc cgaccu   acaccggaaa    u
   cg    cc     agucuc   a    u    a  ua  -      uuu          ucuu 
Get sequence
Deep sequencing
1117 reads, 41.9 reads per million, 117 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 81133196-81133308 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1250
hsa-mir-1250chr17: 81133196-81133308 [-]
hsa-mir-338chr17: 81125883-81125949 [-]
hsa-mir-3065chr17: 81125877-81125955 [+]
hsa-mir-657chr17: 81125276-81125373 [-]
Database links

Mature sequence hsa-miR-1250-5p

Accession MIMAT0005902
Sequence

24 - 

acggugcuggauguggccuuu

 - 44

Get sequence
Deep sequencing1081 reads, 105 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-1250-3p

Accession MIMAT0026740
Sequence

63 - 

acauuuuccagcccauuca

 - 81

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).