Stem-loop sequence hsa-mir-1245b

AccessionMI0017431 (change log)
Symbol HGNC:MIR1245B
DescriptionHomo sapiens miR-1245b stem-loop
Gene family MIPF0000620; mir-1245
Literature search

5 open access papers mention hsa-mir-1245b
(46 sentences)

Stem-loop
   u    a                 -  uaaa  -  a 
5'  uuau uguaggccuuuagauca cu    ga gu u
    |||| ||||||||||||||||| ||    || || u
3'  aaua auauccggaaaucuagu ga    cu ca c
   a    c                 a  ----  a  a 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 188978093-188978161 [-]
sense
OTTHUMT00000334695 ; AC068718.1-001; intron 2
ENST00000434418 ; LINC01090-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-1245b
hsa-mir-1245bchr2: 188978093-188978161 [-]
hsa-mir-1245achr2: 188978092-188978161 [+]
Database links

Mature sequence hsa-miR-1245b-5p

Accession MIMAT0019950
Sequence

9 - 

uaggccuuuagaucacuuaaa

 - 29

Get sequence
Deep sequencing31 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-1245b-3p

Accession MIMAT0019951
Sequence

42 - 

ucagaugaucuaaaggccuaua

 - 63

Get sequence
Deep sequencing42 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).