Stem-loop sequence hsa-mir-1206

AccessionMI0006339 (change log)
Symbol HGNC:MIR1206
DescriptionHomo sapiens miR-1206 stem-loop
Gene family MIPF0000634; mir-1206
Literature search

3 open access papers mention hsa-mir-1206
(10 sentences)

Stem-loop
             g   -a   uu    u  ug 
5' caguguucau uag  ugu  aagc cu  c
   |||||||||| |||  |||  |||| ||   
3' gucgcaagug auc  acg  uuug ga  a
             -   ga   uu    -  ug 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 128008898-128008956 [+]
sense
OTTHUMT00000381637 ; RP11-645E10.1-001; intron 3
ENST00000519319 ; PCAT1-001; intron 3
Database links

Mature sequence hsa-miR-1206

Accession MIMAT0005870
Sequence

4 - 

uguucauguagauguuuaagc

 - 24

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).