Stem-loop sequence hsa-mir-1204

AccessionMI0006337 (change log)
Symbol HGNC:MIR1204
DescriptionHomo sapiens miR-1204 stem-loop
Gene family MIPF0000671; mir-1204
Literature search

11 open access papers mention hsa-mir-1204
(13 sentences)

Stem-loop
      u  u   cug   uc    a  ug     a 
5' acc cg ggc   guc  cauu uu  agaug g
   ||| || |||   |||  |||| ||  ||||| u
3' ugg gc ccg   cag  gugg ag  ucuac u
      u  u   -ug   ga    -  gu     a 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 127795962-127796028 [+]
antisense
OTTHUMT00000381548 ; RP11-351C8.1-001; intron 1
ENST00000520224 ; RP11-351C8.1-001; intron 1
Database links

Mature sequence hsa-miR-1204

Accession MIMAT0005868
Sequence

4 - 

ucguggccuggucuccauuau

 - 24

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).