Stem-loop sequence hsa-mir-1203

AccessionMI0006335 (change log)
Symbol HGNC:MIR1203
DescriptionHomo sapiens miR-1203 stem-loop
Gene family MIPF0000633; mir-1203
Literature search

3 open access papers mention hsa-mir-1203
(4 sentences)

Stem-loop
   u   c -    a    g   gcag  ca      a c      u 
5'  ccu c ccgg gcca gau    cu  agccac g agggug u
    ||| | |||| |||| |||    ||  |||||| | |||||| u
3'  gga g gguc cggu uua    ga  ucggug c ucucgc a
   -   c u    g    g   ----  cc      a u      g 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 48156427-48156511 [-]
antisense
OTTHUMT00000366487 ; ITGA3-016; exon 4
OTTHUMT00000366485 ; ITGA3-014; intron 6
OTTHUMT00000366299 ; ITGA3-002; exon 18
OTTHUMT00000366298 ; ITGA3-001; 3'UTR (exon 20)
OTTHUMT00000440087 ; ITGA3-020; 3'UTR (exon 20)
ENST00000515147 ; ITGA3-016; exon 4
ENST00000506827 ; ITGA3-014; intron 6
ENST00000505306 ; ITGA3-002; exon 18
ENST00000320031 ; ITGA3-001; 3'UTR (exon 20)
ENST00000007722 ; ITGA3-020; 3'UTR (exon 20)
Database links

Mature sequence hsa-miR-1203

Accession MIMAT0005866
Sequence

6 - 

cccggagccaggaugcagcuc

 - 26

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).