Stem-loop sequence hsa-mir-1200

AccessionMI0006332 (change log)
Symbol HGNC:MIR1200
DescriptionHomo sapiens miR-1200 stem-loop
Gene family MIPF0001036; mir-1200
Literature search

6 open access papers mention hsa-mir-1200
(6 sentences)

Stem-loop
   u    cu  u     -gcca         uc    a   g 
5'  gcua  uc ccuga     uucugagcc  aauc cuu c
    ||||  || |||||     |||||||||  |||| |||  
3'  cgau  ag ggacu     aggacuugg  uuag gag c
   c    --  -     guuua         --    a   a 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 36919357-36919432 [-]
sense
OTTHUMT00000337934 ; ELMO1-018; intron 2
OTTHUMT00000337932 ; ELMO1-016; intron 2
OTTHUMT00000219863 ; ELMO1-002; intron 3
OTTHUMT00000337935 ; ELMO1-019; intron 3
OTTHUMT00000219830 ; ELMO1-001; intron 18
OTTHUMT00000337924 ; ELMO1-008; intron 18
OTTHUMT00000337919 ; ELMO1-003; intron 18
ENST00000487843 ; ELMO1-018; intron 2
ENST00000464262 ; ELMO1-016; intron 2
ENST00000396045 ; ELMO1-002; intron 3
ENST00000396040 ; ELMO1-019; intron 3
ENST00000341056 ; ELMO1-201; intron 6
ENST00000310758 ; ELMO1-001; intron 18
ENST00000442504 ; ELMO1-008; intron 18
ENST00000448602 ; ELMO1-003; intron 18
Database links

Mature sequence hsa-miR-1200

Accession MIMAT0005863
Sequence

9 - 

cuccugagccauucugagccuc

 - 30

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).