Stem-loop sequence hsa-mir-1199

AccessionMI0020340 (change log)
Symbol HGNC:MIR1199
DescriptionHomo sapiens miR-1199 stem-loop
Gene family MIPF0001659; mir-1199
Literature search

1 open access papers mention hsa-mir-1199
(13 sentences)

Stem-loop
   ---  cc     c     -       u ag     gccgcgcaggccgugaacucgucga 
5'    ag  ugcgc ggagc cggggcc g  cccgg                         g
      ||  ||||| ||||| ||||||| |  |||||                         c
3'    uc  gcgcg ccucg gccccgg c  gggcc                         u
   agg  cc     c     c       u cu     guccaacucguggccggcgugcgcg 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 14073361-14073479 [+]
antisense
OTTHUMT00000458510 ; RFX1-001; 3'UTR (exon 21)
ENST00000254325 ; RFX1-001; 3'UTR (exon 21)
Database links

Mature sequence hsa-miR-1199-5p

Accession MIMAT0031119
Sequence

21 - 

ccugagcccgggccgcgcag

 - 40

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-1199-3p

Accession MIMAT0031120
Sequence

65 - 

ugcggccggugcucaaccugc

 - 85

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence not experimental
Predicted targets

References

1