Stem-loop sequence hsa-mir-1197

AccessionMI0006656 (change log)
Symbol HGNC:MIR1197
DescriptionHomo sapiens miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Literature search

4 open access papers mention hsa-mir-1197
(4 sentences)

Stem-loop
   acuuccu      -u     ugc   u       gug g    - uuu 
5'        gguauu  gaaga   ggu gaccaug   u uacg c   a
          ||||||  |||||   ||| |||||||   | |||| |   u
3'        cuauaa  cuucu   uca cugguac   g augc g   u
   ------a      cu     ---   u       aca g    a ugu 
Get sequence
Deep sequencing
260 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB5_330 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101025564-101025651 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-1197
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
Database links

Mature sequence hsa-miR-1197

Accession MIMAT0005955
Sequence

57 - 

uaggacacauggucuacuucu

 - 77

Get sequence
Deep sequencing252 reads, 71 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).