Stem-loop sequence hsa-mir-1193

AccessionMI0014205 (change log)
Symbol HGNC:MIR1193
DescriptionHomo sapiens miR-1193 stem-loop
Gene family MIPF0000714; mir-1193
Literature search

3 open access papers mention hsa-mir-1193
(7 sentences)

Stem-loop
   gua    a g       -    c      g    cu  au 
5'    gcug g ggauggu agac ggugac ugca  uc  u
      |||| | ||||||| |||| |||||| ||||  ||   
3'    cgac c ccuauca uuug ccacug augu  ag  u
   ccg    - a       g    c      g    --  ca 
Get sequence
Deep sequencing
92 reads, 52.4 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101030052-101030129 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-1193
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
Database links

Mature sequence hsa-miR-1193

Accession MIMAT0015049
Sequence

10 - 

gggaugguagaccggugacgugc

 - 32

Get sequence
Deep sequencing86 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).