Stem-loop sequence hsa-mir-1185-2

AccessionMI0003821 (change log)
Symbol HGNC:MIR1185-2
DescriptionHomo sapiens miR-1185-2 stem-loop
Gene family MIPF0000018; mir-154
Literature search

4 open access papers mention hsa-mir-1185-2
(4 sentences)

Stem-loop
   u       u    -     ga a              a  uga 
5'  uugguac uaaa gagag  u cccuuuguauguuc cu   u
    ||||||| |||| |||||  | |||||||||||||| ||    
3'  aacuaug guuu cucuc  a gggggacauauaag gg   u
   a       c    a     ag -              c  uaa 
Get sequence
Deep sequencing
4089 reads, 2.56 reads per million, 117 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis [1], and validated by cloning independently by Subramanian et al [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101044198-101044283 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-1185-2
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
Database links

Mature sequence hsa-miR-1185-5p

Accession MIMAT0005798
Previous IDshsa-miR-1185
Sequence

15 - 

agaggauacccuuuguauguu

 - 35

Get sequence
Deep sequencing2606 reads, 104 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-1185-2-3p

Accession MIMAT0022713
Sequence

53 - 

auauacagggggagacucucau

 - 74

Get sequence
Deep sequencing2776 reads, 107 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).