Stem-loop sequence hsa-mir-1184-1

AccessionMI0006277 (change log)
Previous IDshsa-mir-1184
Symbol HGNC:MIR1184-1
DescriptionHomo sapiens miR-1184-1 stem-loop
Gene family MIPF0000592; mir-1184
Literature search

5 open access papers mention hsa-mir-1184-1
(18 sentences)

Stem-loop
     ug a   c    ugaa      g   ---c    ca    ucaaca    cca 
5' cu  c gaa gagg    ggaggu guu    ugcu  gcag      gugg   c
   ||  | ||| ||||    |||||| |||    ||||  ||||      ||||    
3' gg  g cuu uucc    ccuucg uag    gcga  cguc      cacc   a
     gu -   -    ugug      g   uuca    --    ------    ucu 
Get sequence
Deep sequencing
20 reads, 180 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 154887360-154887458 [-]
sense
OTTHUMT00000058821 ; TMLHE-005; intron 1
ENST00000474677 ; TMLHE-005; intron 1
Database links

Mature sequence hsa-miR-1184

Accession MIMAT0005829
Sequence

61 - 

ccugcagcgacuugauggcuucc

 - 83

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).