Stem-loop sequence hsa-mir-1179

AccessionMI0006272 (change log)
Symbol HGNC:MIR1179
DescriptionHomo sapiens miR-1179 stem-loop
Gene family MIPF0000632; mir-1179
Literature search

3 open access papers mention hsa-mir-1179
(5 sentences)

Stem-loop
         -----      a   --         c        gu ugua 
5' ggcugg     aaagga gaa  gcauucuuu auugguug  g    u
   ||||||     |||||| |||  ||||||||| ||||||||  |     
3' ucgauc     uuuccu uuu  cguaggaga uaaccaac  u    u
         agucu      a   ac         a        ug uccg 
Get sequence
Deep sequencing
1130 reads, 0 reads per million, 104 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 88608107-88608197 [+]
antisense
OTTHUMT00000416155 ; NTRK3-017; intron 1
OTTHUMT00000415275 ; NTRK3-004; intron 10
OTTHUMT00000416153 ; NTRK3-015; intron 10
OTTHUMT00000415277 ; NTRK3-003; intron 11
OTTHUMT00000403049 ; NTRK3-002; intron 11
OTTHUMT00000309066 ; NTRK3-001; intron 13
ENST00000558306 ; NTRK3-017; intron 1
ENST00000557856 ; NTRK3-004; intron 10
ENST00000558676 ; NTRK3-015; intron 10
ENST00000542733 ; NTRK3-003; intron 11
ENST00000540489 ; NTRK3-002; intron 11
ENST00000357724 ; NTRK3-203; intron 11
ENST00000360948 ; NTRK3-204; intron 12
ENST00000355254 ; NTRK3-202; intron 12
ENST00000317501 ; NTRK3-201; intron 12
ENST00000394480 ; NTRK3-001; intron 13
Clustered miRNAs
< 10kb from hsa-mir-1179
hsa-mir-1179chr15: 88608107-88608197 [+]
hsa-mir-7-2chr15: 88611825-88611934 [+]
hsa-mir-3529chr15: 88611847-88611924 [-]
Database links

Mature sequence hsa-miR-1179

Accession MIMAT0005824
Sequence

15 - 

aagcauucuuucauugguugg

 - 35

Get sequence
Deep sequencing1106 reads, 103 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).