Stem-loop sequence hsa-mir-10b

Accession MI0000267
Symbol HGNC:MIR10B
Description Homo sapiens miR-10b stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cca      guaa     u        a    g     c          -ug   u 
   gagguu    cguug cuauauau cccu uagaa cgaauuugug   gua c
   ||||||    ||||| |||||||| |||| ||||| ||||||||||   |||  
   cuucaa    guagc gguauaua gggg aucuu gcuuagacac   uau c
--a      aaac     u        a    -     a          uga   g 
Get sequence
Deep sequencing
31052 reads, 53 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Michael et al. subsequently verified expression of miR-10b in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 177015031-177015140 [+]
sense
OTTHUMT00000334248 ; HOXD3-002; intron 1
OTTHUMT00000334248 ; HOXD3-002; intron 1
OTTHUMT00000334246 ; HOXD3-005; 3'UTR (exon 1)
OTTHUMT00000334248 ; HOXD3-002; intron 1
OTTHUMT00000334246 ; HOXD3-005; 3'UTR (exon 1)
ENST00000432796 ; HOXD3-002; intron 1
ENST00000432796 ; HOXD3-002; intron 1
ENST00000468418 ; HOXD3-005; 3'UTR (exon 1)
ENST00000432796 ; HOXD3-002; intron 1
ENST00000468418 ; HOXD3-005; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-10b-5p

Accession MIMAT0000254
Previous IDs hsa-miR-10b
Sequence

27 - 

uacccuguagaaccgaauuugug

 - 49

Get sequence
Deep sequencing 30176 reads, 52 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-10b-3p

Accession MIMAT0004556
Previous IDs hsa-miR-10b*
Sequence

66 - 

acagauucgauucuaggggaau

 - 87

Get sequence
Deep sequencing 876 reads, 18 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).