Stem-loop sequence hsa-mir-103b-1

AccessionMI0007261 (change log)
Previous IDshsa-mir-103-1-as
Symbol HGNC:MIR103B1
DescriptionHomo sapiens miR-103b-1 stem-loop
Gene family MIPF0000024; mir-103
Literature search

212 open access papers mention hsa-mir-103b-1
(829 sentences)

Stem-loop
   ucaua  -c  g    a        gaucca 
5'      gc  cu uaca ugcugcuu      u
        ||  || |||| ||||||||      a
3'      cg  ga augu acgacgga      u
   --agc  aa  a    c        acaacg 
Get sequence
Deep sequencing
6 reads, 233 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 168560904-168560965 [+]
antisense
OTTHUMT00000252792 ; SLIT3-001; intron 4
OTTHUMT00000371504 ; SLIT3-002; intron 4
OTTHUMT00000371505 ; SLIT3-003; intron 4
OTTHUMT00000376173 ; SLIT3-008; intron 4
ENST00000519560 ; SLIT3-001; intron 4
ENST00000332966 ; SLIT3-002; intron 4
ENST00000518140 ; SLIT3-003; intron 4
ENST00000521130 ; SLIT3-008; intron 4
ENST00000404867 ; SLIT3-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-103b-1
hsa-mir-103a-1chr5: 168560896-168560973 [-]
hsa-mir-103b-1chr5: 168560904-168560965 [+]
Database links

Mature sequence hsa-miR-103b

Accession MIMAT0007402
Previous IDshsa-miR-103-as
Sequence

1 - 

ucauagcccuguacaaugcugcu

 - 23

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; ChIP-seq [1]
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).