Stem-loop sequence hsa-mir-1-2

Accession MI0000437
Previous IDs hsa-mir-1d
Symbol HGNC:MIR1-2
Description Homo sapiens miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a      c                     ac     ugaaca 
 ccuacu agaguacauacuucuuuaugu  ccaua      u
 |||||| |||||||||||||||||||||  |||||       
 ggaugg uuuuauguaugaagaaaugua  gguau      a
c      u                     -a     cguaac 
Get sequence
Deep sequencing
29359 reads, 30 experiments
Comments

Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MI0000651 , mouse MI0000139 ), and mir-1-2 (human MI0000437 , mouse MI0000652 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 19408965-19409049 [-]
sense
OTTHUMT00000445571 ; RP11-268I9.2-001; exon 3
OTTHUMT00000445572 ; RP11-268I9.2-003; exon 3
ENST00000581072 ; hsa-mir-133a-1.1-001; exon 3
ENST00000581613 ; hsa-mir-133a-1.1-003; exon 3
antisense
OTTHUMT00000254675 ; MIB1-001; intron 12
OTTHUMT00000254675 ; MIB1-001; intron 12
OTTHUMT00000445642 ; MIB1-004; intron 12
OTTHUMT00000254675 ; MIB1-001; intron 12
ENST00000261537 ; MIB1-001; intron 12
ENST00000261537 ; MIB1-001; intron 12
ENST00000578646 ; MIB1-004; intron 12
ENST00000261537 ; MIB1-001; intron 12
Clustered miRNAs
< 10kb from hsa-mir-1-2
hsa-mir-1-2 chr18: 19408965-19409049 [-]
hsa-mir-133a-1 chr18: 19405659-19405746 [-]
Database links

Mature sequence hsa-miR-1

Accession MIMAT0000416
Sequence

53 - 

uggaauguaaagaaguauguau

 - 74

Get sequence
Deep sequencing 58703 reads, 29 experiments
Evidence experimental; cloned [2], Solexa [3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3