|
miRBase |
|
Stem-loop sequence ath-MIR827 |
|||||
| Accession | MI0005383 | ||||
| Description | Arabidopsis thaliana miR827 stem-loop | ||||
| Gene family | MIPF0001113; MIR827_3 | ||||
| Stem-loop |
uuccaugaaacguuauagguuuuuuucuuucucucu -c u u u u a c au ucc
ugcaa cc ugaa g guuuguugau g uaucua ac guugauca u
||||| || |||| | |||||||||| | |||||| || |||||||| u
acguu gg gcuu c caaacaacua c guagau ug uagcuagu g
-cuacgauuuuuguacuagcucuaagguucuucgcu uu u u u c a u gu ugu
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence ath-miR827 |
|
| Accession | MIMAT0004243 |
| Sequence |
106 - uuagaugaccaucaacaaacu - 126 |
| Deep sequencing | 85 reads, 7 experiments |
| Evidence | experimental; 454 [1-2], cloned [2], Solexa [3] |
| Validated targets |
|
References |
|
| 1 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
| 2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
| 3 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|