Stem-loop sequence ame-mir-9b

Accession MI0001597
Description Apis mellifera miR-9b stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uaau   ag   u               c            ccuu 
    gcu  ugc cuuugcuuugguaau uagcuuuaugau    a
    |||  ||| ||||||||||||||| ||||||||||||    a
    cga  acg gaaaugaaaccauua aucgagauacua    u
guuu   aa   -               u            aaau 
Get sequence
Deep sequencing
16 reads, 1 experiments
Genome context
Coordinates (Amel_4.0) Overlapping transcripts
Group15.33: 20325-20416 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-9b
ame-mir-9b Group15.33: 20325-20416 [-]
ame-mir-79 Group15.33: 20314-20413 [+]
ame-mir-306 Group15.33: 20090-20216 [+]
Database links

Mature sequence ame-miR-9b

Accession MIMAT0001492
Sequence

18 - 

gcuuugguaaucuagcuuuauga

 - 40

Get sequence
Deep sequencing 12 reads, 1 experiments
Evidence experimental; RTPCR [1]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).