Stem-loop sequence mmu-mir-9768

AccessionMI0031120 (change log)
DescriptionMus musculus miR-9768 stem-loop
Stem-loop
   -a   -  -a     u   -  u       c    cu   c   aaag   ----   ag  --  a  auc 
5'   gcc gc  gccug ggc ac cggagga ggca  gug agc    cca    ggg  gc  gu gu   c
     ||| ||  ||||| ||| || ||||||| ||||  ||| |||    |||    |||  ||  || ||    
3'   cgg cg  cggac ccg ug guuuccu ccgu  cac ucg    ggu    ccc  cg  cg cg   c
   gc   u  gg     -   g  u       u    --   c   ---a   agaa   ga  aa  a  aac 
Get sequence
Deep sequencing
37 reads, 81.8 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 12947941-12948070 [+]
sense
OTTMUST00000049047 ; Mcf2l-016; intron 1
OTTMUST00000048821 ; Mcf2l-001; intron 1
OTTMUST00000048822 ; Mcf2l-002; intron 1
OTTMUST00000097170 ; Mcf2l-014; intron 1
OTTMUST00000049050 ; Mcf2l-019; intron 1
OTTMUST00000048825 ; Mcf2l-005; exon 1
OTTMUST00000049048 ; Mcf2l-017; 3'UTR (exon 1)
OTTMUST00000048829 ; Mcf2l-009; intron 2
ENSMUST00000110871 ; Mcf2l-017; 3'UTR (exon 1)
ENSMUST00000130302 ; Mcf2l-005; exon 1
ENSMUST00000098927 ; Mcf2l-019; intron 1
ENSMUST00000110879 ; Mcf2l-014; intron 1
ENSMUST00000156405 ; Mcf2l-002; intron 1
ENSMUST00000110876 ; Mcf2l-001; intron 1
ENSMUST00000173099 ; Mcf2l-016; intron 1
ENSMUST00000095456 ; Mcf2l-009; intron 2
Database links

Mature sequence mmu-miR-9768-5p

Accession MIMAT0036459
Sequence

13 - 

uggcacucggaggacggcacugu

 - 35

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-9768-3p

Accession MIMAT0036460
Sequence

95 - 

acugccuuccuuuguguggcccag

 - 118

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24235016 "Extremely complex populations of small RNAs in the mouse retina and RPE/choroid" Soundara Pandi SP, Chen M, Guduric-Fuchs J, Xu H, Simpson DA Invest Ophthalmol Vis Sci. 54:8140-8151(2013).