Stem-loop sequence dre-mir-206-1

AccessionMI0002045 (change log)
DescriptionDanio rerio miR-206-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

14 open access papers mention dre-mir-206-1
(190 sentences)

Stem-loop
   ---    guug       u  ag                gc     uuaau 
5'    gaau    ccucuug ga  acaugcuuccuuauau  ccaua     g
      ||||    ||||||| ||  ||||||||||||||||  |||||     c
3'    uuua    gggggac uu  ugugugaaggaaugua  gguau     u
   cug    --aa       u  gg                -a     ugaac 
Get sequence
Deep sequencing
520403 reads, 3.19e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr20: 19544648-19544746 [-]
sense
OTTDART00000058152 ; si:ch211-101l18.8-001; intron 1
ENSDART00000152763 ; si:ch211-101l18.8-001; intron 1
Clustered miRNAs
< 10kb from dre-mir-206-1
dre-mir-206-1chr20: 19544648-19544746 [-]
dre-mir-133bchr20: 19543379-19543462 [-]
Database links

Mature sequence dre-miR-206-5p

Accession MIMAT0031988
Sequence

21 - 

acaugcuuccuuauaugcccaua

 - 43

Get sequence
Deep sequencing81 reads, 2 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-206-3p

Accession MIMAT0001866
Previous IDsdre-miR-206
Sequence

59 - 

uggaauguaaggaagugugugg

 - 80

Get sequence
Deep sequencing1041898 reads, 5 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).