Stem-loop sequence dre-let-7c-1

AccessionMI0001866 (change log)
DescriptionDanio rerio let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

40 open access papers mention dre-let-7c-1
(208 sentences)

Stem-loop
      a ag    u  a      cu   g   u             uag      gc 
5' cug g  ugug gc uccagg  gag uag agguuguaugguu   aauuuu  c
   ||| |  |||| || ||||||  ||| ||| |||||||||||||   ||||||   
3' gac c  acac cg agguuc  uuc auc uccaacaugucaa   uugagg  c
      - ga    u  -      cu   g   u             ---      gu 
Get sequence
Deep sequencing
311672 reads, 2.14e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 29795823-29795929 [+]
sense
OTTDART00000057551 ; zgc:153372-001; intron 10
ENSDART00000099958 ; zgc:153372-001; intron 10
Clustered miRNAs
< 10kb from dre-let-7c-1
dre-mir-99-1chr15: 29795583-29795666 [+]
dre-let-7c-1chr15: 29795823-29795929 [+]
dre-mir-125cchr15: 29800968-29801052 [+]
Database links

Mature sequence dre-let-7c-5p

Accession MIMAT0001761
Previous IDsdre-let-7c
Sequence

23 - 

ugagguaguagguuguaugguu

 - 44

Get sequence
Deep sequencing622827 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-let-7c-3p

Accession MIMAT0031930
Sequence

68 - 

cuguacaaccuucuagcuuucc

 - 89

Get sequence
Deep sequencing268 reads, 10 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).