Stem-loop sequence mmu-mir-6960

AccessionMI0022807 (change log)
Symbol MGI:Mir6960
DescriptionMus musculus miR-6960 stem-loop
Stem-loop
      ggc    u    a a u       ga     
5' cug   agga gaga g g uuggcug  agcc 
   |||   |||| |||| | | |||||||  ||| c
3' gac   uccu cucu c c aaccgac  ucgu 
      ---    -    c a c       --     
Get sequence
Deep sequencing
3089 reads, 4.41 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 99080805-99080865 [+]
sense
ENSMUST00000039665 ; Troap-201; intron 8
Database links

Mature sequence mmu-miR-6960-5p

Accession MIMAT0027820
Sequence

6 - 

caggaugagaagaguuuggcug

 - 27

Get sequence
Deep sequencing3085 reads, 67 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6960-3p

Accession MIMAT0027821
Sequence

40 - 

agccaaccaccucucuccucag

 - 61

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).