Stem-loop sequence mmu-mir-6918

AccessionMI0022765 (change log)
Symbol MGI:Mir6918
DescriptionMus musculus miR-6918 stem-loop
Literature search

1 open access papers mention mmu-mir-6918
(1 sentences)

Stem-loop
   ucuug  c      c   au       ucug 
5'      ug ugagga ggg  uagguuc    a
        || |||||| |||  |||||||     
3'      ac acucuu ccc  guccgag    a
   ----g  -      -   gu       uaag 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 4891345-4891402 [+]
sense
OTTMUST00000011320 ; Nipsnap1-001; intron 8
OTTMUST00000011321 ; Nipsnap1-002; intron 9
ENSMUST00000038570 ; Nipsnap1-001; intron 8
ENSMUST00000136552 ; Nipsnap1-002; intron 9
Database links

Mature sequence mmu-miR-6918-5p

Accession MIMAT0027736
Sequence

6 - 

ugcugaggacgggauuagguucu

 - 28

Get sequence
Deep sequencing93 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6918-3p

Accession MIMAT0027737
Sequence

37 - 

ugagccugugcccuucucacag

 - 58

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).