Stem-loop sequence hsa-mir-6886

AccessionMI0022733 (change log)
Symbol HGNC:MIR6886
DescriptionHomo sapiens miR-6886 stem-loop
Literature search

3 open access papers mention hsa-mir-6886
(7 sentences)

Stem-loop 
   cuuggccc     -u    u      -  cug 
5'         gcagg  gaga gagggc uc   g
           |||||  |||| |||||| ||    
3'         cgucc  cucu uucccg ag   c
   ---gacuc     uc    c      u  ucg
Get sequence
Deep sequencing
95 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 11113474-11113534 [+]
sense
OTTHUMT00000452639 ; SMARCA4-009; intron 10
OTTHUMT00000403235 ; SMARCA4-001; intron 11
OTTHUMT00000403236 ; SMARCA4-002; intron 11
OTTHUMT00000452638 ; SMARCA4-007; intron 12
OTTHUMT00000403237 ; SMARCA4-005; intron 12
OTTHUMT00000403238 ; SMARCA4-004; intron 12
OTTHUMT00000403239 ; SMARCA4-003; intron 12
ENST00000591545 ; SMARCA4-009; intron 10
ENST00000413806 ; SMARCA4-202; intron 10
ENST00000450717 ; SMARCA4-203; intron 10
ENST00000344626 ; SMARCA4-001; intron 11
ENST00000590574 ; SMARCA4-002; intron 11
ENST00000358026 ; SMARCA4-201; intron 11
ENST00000429416 ; SMARCA4-007; intron 12
ENST00000541122 ; SMARCA4-005; intron 12
ENST00000589677 ; SMARCA4-004; intron 12
ENST00000444061 ; SMARCA4-003; intron 12
Database links

Mature sequence hsa-miR-6886-5p

Accession MIMAT0027672
Sequence

6 -  

cccgcaggugagaugagggcu

 - 26

Get sequence
Deep sequencing60 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6886-3p

Accession MIMAT0027673
Sequence

38 -  

ugcccuucucuccuccugccu

 - 58

Get sequence
Deep sequencing28 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).