Stem-loop sequence hsa-mir-4734

AccessionMI0017371 (change log)
Symbol HGNC:MIR4734
DescriptionHomo sapiens miR-4734 stem-loop
Stem-loop 
        ----    -      gcc        c    cg 
5' cucgg    gccc gaccgc   ggcccgca cucc  g
   |||||    |||| ||||||   |||||||| ||||   
3' gggcc    cggg cuggcg   ucgggcgu gagg  c
        cuag    a      ---        c    cc
Get sequence
Deep sequencing
106 reads, 2.63 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 38702262-38702331 [-]
intergenic
Database links

Mature sequence hsa-miR-4734

Accession MIMAT0019859
Sequence

41 -  

gcugcgggcugcggucagggcg

 - 62

Get sequence
Deep sequencing90 reads, 30 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).