Stem-loop sequence hsa-mir-3133

Accession MI0014153
Description Homo sapiens miR-3133 stem-loop
Stem-loop 
     au                   c      uaaaa 
cagaa  uguaaagaacucuuaaaac caauag     a
|||||  ||||||||||||||||||| ||||||      
gucuu  auauuucuugagaauuuug guuguc     g
     au                   a      caaca
Get sequence
Deep sequencing
26 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 242417320-242417397 [+]
sense
OTTHUMT00000323171 ; FARP2-019; intron 2
OTTHUMT00000323171 ; FARP2-019; intron 2
OTTHUMT00000323171 ; FARP2-019; intron 2
OTTHUMT00000323153 ; FARP2-001; intron 19
OTTHUMT00000323153 ; FARP2-001; intron 19
OTTHUMT00000323153 ; FARP2-001; intron 19
ENST00000491425 ; FARP2-019; intron 2
ENST00000491425 ; FARP2-019; intron 2
ENST00000491425 ; FARP2-019; intron 2
ENST00000264042 ; FARP2-001; intron 19
ENST00000264042 ; FARP2-001; intron 19
ENST00000264042 ; FARP2-001; intron 19
Database links

Mature sequence hsa-miR-3133

Accession MIMAT0014998
Sequence

10 -  

uaaagaacucuuaaaacccaau

 - 31

Get sequence
Deep sequencing 25 reads, 8 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).