Stem-loop sequence hsa-mir-1914

Accession MI0008335
Symbol HGNC:MIR1914
Description Homo sapiens miR-1914 stem-loop
Gene family MIPF0001040; mir-1914
Stem-loop 
c   u a    -g   u    cc     a       uucc 
 gug g gccc  ccc gugc  ggccc cuucugc    u
 ||| | ||||  ||| ||||  ||||| |||||||    c
 cac c cggg  ggg cacg  cuggg gaggacg    u
-   u c    ga   u    cc     -       cgau
Get sequence
Deep sequencing
6 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 62572818-62572897 [-]
sense
OTTHUMT00000080240 ; UCKL1-005; 5'UTR (exon 1)
OTTHUMT00000080240 ; UCKL1-005; 5'UTR (exon 1)
OTTHUMT00000080240 ; UCKL1-005; 5'UTR (exon 1)
OTTHUMT00000080236 ; UCKL1-001; intron 8
OTTHUMT00000080236 ; UCKL1-001; intron 8
OTTHUMT00000080236 ; UCKL1-001; intron 8
ENST00000430743 ; UCKL1-005; 5'UTR (exon 1)
ENST00000430743 ; UCKL1-005; 5'UTR (exon 1)
ENST00000430743 ; UCKL1-005; 5'UTR (exon 1)
ENST00000369892 ; UCKL1-202; intron 7
ENST00000358711 ; UCKL1-201; intron 7
ENST00000369892 ; UCKL1-202; intron 7
ENST00000358711 ; UCKL1-201; intron 7
ENST00000369892 ; UCKL1-202; intron 7
ENST00000358711 ; UCKL1-201; intron 7
ENST00000354216 ; UCKL1-001; intron 8
ENST00000369908 ; UCKL1-203; intron 8
ENST00000354216 ; UCKL1-001; intron 8
ENST00000369908 ; UCKL1-203; intron 8
ENST00000354216 ; UCKL1-001; intron 8
ENST00000369908 ; UCKL1-203; intron 8
Clustered miRNAs
< 10kb from hsa-mir-1914
hsa-mir-647 chr20: 62573984-62574079 [-]
hsa-mir-1914 chr20: 62572818-62572897 [-]
Database links

Mature sequence hsa-miR-1914-5p

Accession MIMAT0007889
Previous IDs hsa-miR-1914
Sequence

13 -  

cccugugcccggcccacuucug

 - 34

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence hsa-miR-1914-3p

Accession MIMAT0007890
Previous IDs hsa-miR-1914*
Sequence

50 -  

ggaggggucccgcacugggagg

 - 71

Get sequence
Deep sequencing 3 reads, 3 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).