Stem-loop sequence cel-mir-1823

Accession MI0007985
Description Caenorhabditis elegans miR-1823 stem-loop
Stem-loop 
c      --    a   c  c     c -  a g        --g a 
 uuugac  cuga cgu ac ccuaa c cu u caguauuu   g g
 ||||||  |||| ||| || ||||| | || | ||||||||   |  
 agacug  gacu gua ug ggauu g ga a gucauaaa   c c
a      uu    c   a  a     u u  - g        aua u
Get sequence
Deep sequencing
2 reads, 2 experiments
Comments

This sequence was erroneously named mir-808 in [1].

Genome context
Coordinates (WBcel215) Overlapping transcripts
I: 12608609-12608698 [+]
intergenic

Mature sequence cel-miR-1823

Accession MIMAT0006590
Sequence

53 -  

uacuggaaguguuuaggaguaa

 - 74

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; 454 [1], Solexa [2]
Validated targets
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).