Stem-loop sequence hsa-mir-320c-1

AccessionMI0003778 (change log)
Symbol HGNC:MIR320C1
DescriptionHomo sapiens miR-320c-1 stem-loop
Gene family MIPF0000163; mir-320
Literature search

145 open access papers mention hsa-mir-320c-1
(592 sentences)

Stem-loop
   --aaaaaugag        uu       c    cag 
5'            gccuucuc  cccaguu uucc   a
              ||||||||  ||||||| ||||    
3'            ugggagag  gggucga aagg   g
   uaaaaaaaaga        uu       a    acu 
Get sequence
Deep sequencing
1359002 reads, 3.57e+03 reads per million, 160 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a candidate by RAKE analysis [1], and later confirmed by Solexa sequencing [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 21683518-21683589 [+]
sense
OTTHUMT00000446105 ; TTC39C-002; intron 6
OTTHUMT00000446107 ; TTC39C-001; intron 6
ENST00000304621 ; TTC39C-002; intron 6
ENST00000317571 ; TTC39C-001; intron 6
Database links

Mature sequence hsa-miR-320c

Accession MIMAT0005793
Sequence

42 - 

aaaagcuggguugagagggu

 - 61

Get sequence
Deep sequencing2828473 reads, 159 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).