Stem-loop sequence hsa-mir-320b-1

AccessionMI0003776 (change log)
Symbol HGNC:MIR320B1
DescriptionHomo sapiens miR-320b-1 stem-loop
Gene family MIPF0000163; mir-320
Literature search

147 open access papers mention hsa-mir-320b-1
(528 sentences)

Stem-loop
   --auaaauuaau       uu       c     ag 
5'             cccucuc  ucuaguu uuccu  a
               |||||||  ||||||| |||||   
3'             gggagag  gggucga aagga  g
   aauuaaacaaac       uu       a     gu 
Get sequence
Deep sequencing
1640806 reads, 5.18e+03 reads per million, 158 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 116671746-116671817 [+]
sense
OTTHUMT00000033486 ; MAB21L3-001; intron 6
ENST00000369500 ; MAB21L3-001; intron 6
Database links

Mature sequence hsa-miR-320b

Accession MIMAT0005792
Sequence

42 - 

aaaagcuggguugagagggcaa

 - 63

Get sequence
Deep sequencing3244238 reads, 159 experiments
Evidence experimental; RAKE [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).