Stem-loop sequence hsa-mir-320b-1

AccessionMI0003776
Symbol HGNC:MIR320B1
DescriptionHomo sapiens miR-320b-1 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---------------------------------aauuaauc    ucu      uu 
5'                                          ccuc   uucuag  c
                                            ||||   ||||||   
3'                                          ggag   gagauc  u
   uuaauuaaucaauuaaacaaacgggagaguugggucgaaaa    --u      cu 
Get sequence
Deep sequencing
82537 reads, 9.8e+03 reads per million, 77 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 116671749-116671827 [+]
sense
OTTHUMT00000033486 ; MAB21L3-001; intron 6
ENST00000369500 ; MAB21L3-001; intron 6
Database links

Mature sequence hsa-miR-320b

Accession MIMAT0005792
Sequence

39 - 

aaaagcuggguugagagggcaa

 - 60

Get sequence
Deep sequencing12409 reads, 67 experiments
Evidence experimental; RAKE [1], Illumina [2-3]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).