Stem-loop sequence hsa-mir-1224

Accession

MI0003764

Symbol

HGNC:MIR1224

Description

Homo sapiens miR-1224 stem-loop

Gene family

MIPF0000440; mir-1224

Stem-loop

g      cuc         a   u  u  cgccggggccgg 
 ugagga   gggaggugg ggg gg gc            g
 ||||||   ||||||||| ||| || ||            c
 acuccu   uccuccacc ccc cu cg            g
g      cuc         c   u  u  cucgacuuuguc 

Deep sequencing

9 reads, 6 experiments

Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by more extensive cloning [2].

Genome context

• Coordinates (GRCh37.p5): chr3: 183959193-183959277 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000346005 ; VWA5B2-002; intron 13

  OTTHUMT00000346005 ; VWA5B2-002; intron 13

  OTTHUMT00000346005 ; VWA5B2-002; intron 13

  OTTHUMT00000346333 ; EIF2B5-017; intron 15

  OTTHUMT00000346333 ; EIF2B5-017; intron 15

  OTTHUMT00000346333 ; EIF2B5-017; intron 15

  OTTHUMT00000346009 ; VWA5B2-006; intron 16

  OTTHUMT00000346009 ; VWA5B2-006; intron 16

  OTTHUMT00000346009 ; VWA5B2-006; intron 16

  OTTHUMT00000346004 ; VWA5B2-001; intron 18

  OTTHUMT00000346004 ; VWA5B2-001; intron 18

  OTTHUMT00000346004 ; VWA5B2-001; intron 18

  ENST00000461141 ; VWA5B2-002; intron 13

  ENST00000461141 ; VWA5B2-002; intron 13

  ENST00000461141 ; VWA5B2-002; intron 13

  ENST00000444495 ; EIF2B5-017; intron 15

  ENST00000444495 ; EIF2B5-017; intron 15

  ENST00000444495 ; EIF2B5-017; intron 15

  ENST00000273794 ; VWA5B2-006; intron 16

  ENST00000273794 ; VWA5B2-006; intron 16

  ENST00000273794 ; VWA5B2-006; intron 16

  ENST00000426955 ; VWA5B2-001; intron 18

  ENST00000426955 ; VWA5B2-001; intron 18

  ENST00000426955 ; VWA5B2-001; intron 18

Database links

• ENTREZGENE: 100187716;MIR1224
• HGNC: 33923;MIR1224

Mature sequence hsa-miR-1224-5p

• Accession: MIMAT0005458
• Sequence: 1 - gugaggacucgggaggugg - 19
• Deep sequencing: 5 reads, 4 experiments
• Evidence: experimental; RAKE [1], cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1224-5p
  • MICRORNA.ORG:hsa-miR-1224-5p
  • MIRDB:hsa-miR-1224-5p
  • RNA22-HSA:hsa-miR-1224-5p
  • TARGETMINER:hsa-miR-1224-5p
  • TARGETSCAN-VERT:hsa-miR-1224-5p

Mature sequence hsa-miR-1224-3p

• Accession: MIMAT0005459
• Sequence: 65 - ccccaccuccucucuccucag - 85
• Deep sequencing: 2 reads, 1 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1224-3p
  • MICRORNA.ORG:hsa-miR-1224-3p
  • MIRDB:hsa-miR-1224-3p
  • RNA22-HSA:hsa-miR-1224-3p
  • TARGETMINER:hsa-miR-1224-3p
  • TARGETSCAN-VERT:hsa-miR-1224-3p

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).