Stem-loop sequence rno-mir-24-2

Accession MI0000855
Description Rattus norvegicus miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-   -u    ---cu     ccgc       g   a         aa    ug  u 
 gcc  cucc     gggcu    cuccugu ccu cugagcuga  cagu  au c
 |||  ||||     |||||    ||||||| ||| |||||||||  ||||  ||  
 cgg  gagg     cccga    gaggaca gga gacuugacu  guca  ug c
a   uc    auacc     -ccu       a   c         cg    cg  a 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
19: 25638430-25638537 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-24-2
rno-mir-23a 19: 25638744-25638818 [-]
rno-mir-27a 19: 25638578-25638664 [-]
rno-mir-24-2 19: 25638430-25638537 [-]
Database links

Mature sequence rno-miR-24-2-5p

Accession MIMAT0005441
Previous IDs rno-miR-24-2*
Sequence

25 - 

gugccuacugagcugaaacagu

 - 46

Get sequence
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-24-3p

Accession MIMAT0000794
Previous IDs rno-miR-24
Sequence

61 - 

uggcucaguucagcaggaacag

 - 82

Get sequence
Evidence experimental; cloned [1-4], Northern [2], SOLiD [5]

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).