Stem-loop sequence hsa-mir-300

AccessionMI0005525 (change log)
Symbol HGNC:MIR300
DescriptionHomo sapiens miR-300 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --    a   ga      guaa     ---cacg    u  uu 
5'   ugcu cuu  agagag    uccuu       cauu gc  u
     |||| |||  ||||||    |||||       |||| ||  a
3'   acga ggg  ucucuc    gggaa       guaa cg  c
   aa    g   uc      agac     cauauua    -  uu 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101041363-101041445 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-300
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
Database links

Mature sequence hsa-miR-300

Accession MIMAT0004903
Sequence

52 - 

uauacaagggcagacucucucu

 - 73

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence by similarity; MI0000400
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).