Stem-loop sequence mmu-mir-708

Accession

MI0004692

Symbol

MGI:Mir708

Description

Mus musculus miR-708 stem-loop

Gene family

MIPF0000397; mir-708

Stem-loop

cuguguuugaaa     --a        a           a     c  g gg   a  a 
            ugggg   cugcccuc aggagcuuaca ucuag ug g  uag ug c
            |||||   |||||||| ||||||||||| ||||| || |  ||| || u
            auucc   gacgggag ucuucgagugu agauc ac c  guu ac u
------------     ggg        a           c     a  a aa   c  g 

Deep sequencing

98366 reads, 82 experiments

Genome context

• Coordinates (GRCm38): chr7: 96249424-96249532 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000050349 ; Odz4-011; intron 1

  OTTMUST00000050348 ; Odz4-010; intron 1

  OTTMUST00000050347 ; Odz4-009; intron 1

  OTTMUST00000050323 ; Odz4-004; intron 1

  OTTMUST00000050322 ; Odz4-003; intron 1

  OTTMUST00000050321 ; Odz4-002; intron 1

  OTTMUST00000050320 ; Odz4-001; intron 1

  ENSMUST00000107165 ; Odz4-010; intron 1

  ENSMUST00000107166 ; Odz4-009; intron 1

  ENSMUST00000138760 ; Odz4-004; intron 1

  ENSMUST00000129445 ; Odz4-002; intron 1

  ENSMUST00000133770 ; Odz4-011; intron 1

  ENSMUST00000144263 ; Odz4-003; intron 1

  ENSMUST00000107162 ; Odz4-001; intron 1

Database links

• ENTREZGENE: 735284;Mir708
• MGI: 3629686;Mir708

Mature sequence mmu-miR-708-5p

• Accession: MIMAT0004828
• Previous IDs: mmu-miR-708
• Sequence: 27 - aaggagcuuacaaucuagcuggg - 49
• Deep sequencing: 62307 reads, 65 experiments
• Evidence: experimental; cloned [3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-708-5p
  • MICRORNA.ORG:mmu-miR-708-5p
  • MIRDB:mmu-miR-708-5p
  • RNA22-MMU:mmu-miR-708-5p
  • TARGETSCAN-VERT:mmu-miR-708

Mature sequence mmu-miR-708-3p

• Accession: MIMAT0003498
• Previous IDs: mmu-miR-708;mmu-miR-708*
• Sequence: 73 - caacuagacugugagcuucuag - 94
• Deep sequencing: 4213 reads, 52 experiments
• Evidence: experimental; MPSS [1], miRAP-cloned [2], cloned [3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-708-3p
  • MICRORNA.ORG:mmu-miR-708-3p
  • MIRDB:mmu-miR-708-3p
  • RNA22-MMU:mmu-miR-708-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).