Stem-loop sequence rno-mir-25

Accession MI0000856
Description Rattus norvegicus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop 
    a ug   ag    g      c g     u   --  ac 
ggcc g  uug  aggc gagaca g gcaau gcu  gg  g
|||| |  |||  |||| |||||| | ||||| |||  ||  c
ccgg c  gac  ucug cucugu c cguua cgg  cc  u
    c gu   ag    g      u a     -   gu  cg
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
12: 17607970-17608053 [-]
sense
ENSRNOT00000001825 ; Mcm7; intron 12
ENSRNOT00000001825 ; Mcm7; intron 12
ENSRNOT00000001825 ; Mcm7; intron 12
Clustered miRNAs
< 10kb from rno-mir-25
rno-mir-106b 12: 17608382-17608463 [-]
rno-mir-93 12: 17608173-17608259 [-]
rno-mir-25 12: 17607970-17608053 [-]
Database links
  • ENTREZGENE: 100314004;Mir25

Mature sequence rno-miR-25-5p

Accession MIMAT0004713
Previous IDs rno-miR-25*
Sequence

14 -  

aggcggagacacgggcaauugc

 - 35

Get sequence
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-25-3p

Accession MIMAT0000795
Previous IDs rno-miR-25
Sequence

52 -  

cauugcacuugucucggucuga

 - 73

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Validated targets
Predicted targets

References

1
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).