Stem-loop sequence hsa-mir-337

AccessionMI0000806
Symbol HGNC:MIR337
DescriptionHomo sapiens miR-337 stem-loop
Gene family MIPF0000195; mir-337
Stem-loop
   guagucagua uu         -   c   u     c        -   ca 
5'           g  ggggggugg gaa ggc ucaua aggaguug aug  c
             |  ||||||||| ||| ||| ||||| |||||||| |||   
3'           c  uccccuacu cuu ccg aguau uccucgac uau  a
   --------aa -u         u   u   u     a        c   ug 
Get sequence
Deep sequencing
1479 reads, 792 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted based on homology with a verified rat miRNA [1,2], and later confirmed in human [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 100874493-100874585 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-337
hsa-mir-493chr14: 100869060-100869148 [+]
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
Database links

Mature sequence hsa-miR-337-5p

Accession MIMAT0004695
Sequence

23 - 

gaacggcuucauacaggaguu

 - 43

Get sequence
Deep sequencing40 reads, 23 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-337-3p

Accession MIMAT0000754
Previous IDshsa-miR-337
Sequence

61 - 

cuccuauaugaugccuuucuuc

 - 82

Get sequence
Deep sequencing896 reads, 36 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).