Stem-loop sequence hsa-mir-340

AccessionMI0000802
Symbol HGNC:MIR340
DescriptionHomo sapiens miR-340 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop
   --uu     u      au       -caa      u    g     ug 
5'     guacc ggugug  uauaaag    ugagac gauu ucaua  u
       ||||| ||||||  |||||||    |||||| |||| |||||  c
3'     uaugg ccauac  auauuuc    acucug cuag ggugu  g
   auuc     u      cg       auug      c    -     uu 
Get sequence
Deep sequencing
9764 reads, 774 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 180015303-180015397 [-]
intergenic
Database links

Mature sequence hsa-miR-340-5p

Accession MIMAT0004692
Previous IDshsa-miR-340
Sequence

16 - 

uuauaaagcaaugagacugauu

 - 37

Get sequence
Deep sequencing329 reads, 50 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-340-3p

Accession MIMAT0000750
Previous IDshsa-miR-340;hsa-miR-340*
Sequence

58 - 

uccgucucaguuacuuuauagc

 - 79

Get sequence
Deep sequencing93 reads, 25 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).