|
miRBase |
|
Mature sequence hsa-miR-377-5p |
|
| Accession | MIMAT0004689 |
| Previous IDs | hsa-miR-377* |
| Sequence |
7 - agagguugcccuuggugaauuc - 28 |
| Deep sequencing | 31 reads, 1 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
Mature sequence hsa-miR-377-3p |
|
| Accession | MIMAT0000730 |
| Previous IDs | hsa-miR-377 |
| Sequence |
45 - aucacacaaaggcaacuuuugu - 66 |
| Deep sequencing | 18 reads, 5 experiments |
| Evidence | experimental; cloned [1-3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|