Stem-loop sequence hsa-mir-146a

Accession

MI0000477

Previous IDs

hsa-mir-146

Symbol

HGNC:MIR146A

Description

Homo sapiens miR-146a stem-loop

Gene family

MIPF0000103; mir-146

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Stem-loop

c     -----u      u     uu            c  u     g  uc 
 cgaug      guaucc cagcu  gagaacugaauu ca ggguu ug  a
 |||||      |||||| |||||  |||||||||||| || ||||| ||  g
 gcuac      uauagg gucga  uucuugacuuaa gu uccag ac  u
u     ugucuc      -     -c            a  c     -  ug 

Deep sequencing

133957 reads, 37 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3].

Genome context

• Coordinates (GRCh37.p5): chr5: 159912359-159912457 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000374137 ; CTC-231O11.1-001; exon 2

  OTTHUMT00000374137 ; CTC-231O11.1-001; exon 2

  OTTHUMT00000374137 ; CTC-231O11.1-001; exon 2

  ENST00000517927 ; CTC-231O11.1-001; exon 2

  ENST00000517927 ; CTC-231O11.1-001; exon 2

  ENST00000517927 ; hsa-mir-146a.1-001; exon 2

Database links

• ENTREZGENE: 406938;MIR146A
• HGNC: 31533;MIR146A

Mature sequence hsa-miR-146a-5p

• Accession: MIMAT0000449
• Previous IDs: hsa-miR-146;hsa-miR-146a
• Sequence: 21 - ugagaacugaauuccauggguu - 42
• Deep sequencing: 133760 reads, 37 experiments
• Evidence: experimental; cloned [2-3]
• Validated targets:
  • TARBASE:hsa-miR-146a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-146a-5p
  • MICRORNA.ORG:hsa-miR-146a-5p
  • MIRDB:hsa-miR-146a-5p
  • RNA22-HSA:hsa-miR-146a-5p
  • TARGETMINER:hsa-miR-146a-5p
  • TARGETSCAN-VERT:hsa-miR-146a

Mature sequence hsa-miR-146a-3p

• Accession: MIMAT0004608
• Previous IDs: hsa-miR-146a*
• Sequence: 57 - ccucugaaauucaguucuucag - 78
• Deep sequencing: 197 reads, 10 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-146a-3p
  • MICRORNA.ORG:hsa-miR-146a-3p
  • MIRDB:hsa-miR-146a-3p
  • RNA22-HSA:hsa-miR-146a-3p
  • TARGETMINER:hsa-miR-146a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).