Stem-loop sequence hsa-mir-219-1

Accession MI0000296
Previous IDs hsa-mir-219
Symbol HGNC:MIR219-1
Description Homo sapiens miR-219-1 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-    c --------c    c       cu   u     a  g         a   uau 
 ccgc c         gggc gcggcuc  gau gucca ac caauucucg guc   g
 |||| |         |||| |||||||  ||| ||||| || ||||||||| |||   g
 ggcg g         cccg cgccgag  cug caggu ug guugagagc cgg   c
g    a cuccaaacc    c       cc   -     c  a         -   ccu 
Get sequence
Deep sequencing
308 reads, 25 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the 5' excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later validated in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MI0000296 ) and mir-219-2 on chromosome 9 (MI0000740 ) [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 33175612-33175721 [+]
intergenic
Database links

Mature sequence hsa-miR-219-5p

Accession MIMAT0000276
Previous IDs hsa-miR-219
Sequence

21 - 

ugauuguccaaacgcaauucu

 - 41

Get sequence
Deep sequencing 102 reads, 13 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-219-1-3p

Accession MIMAT0004567
Sequence

62 - 

agaguugagucuggacgucccg

 - 83

Get sequence
Deep sequencing 99 reads, 13 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).