Stem-loop sequence hsa-mir-20a

Accession MI0000076
Previous IDs hsa-mir-20
Symbol HGNC:MIR20A
Description Homo sapiens miR-20a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    c   -a                 g   -  uu 
guag acu  aagugcuuauagugcag uag ug  u
|||| |||  ||||||||||||||||| ||| ||   
cguc uga  uucacgaguauuacguc auc au  a
    a   aa                 -   u  ug 
Get sequence
Deep sequencing
9929 reads, 52 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 92003319-92003389 [+]
sense
OTTHUMT00000442497 ; MIR17HG-002; exon 2
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000442498 ; MIR17HG-003; exon 3
ENST00000582141 ; MIR17HG-002; exon 2
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000581816 ; MIR17HG-003; exon 3
Clustered miRNAs
< 10kb from hsa-mir-20a
hsa-mir-17 chr13: 92002859-92002942 [+]
hsa-mir-18a chr13: 92003005-92003075 [+]
hsa-mir-19a chr13: 92003145-92003226 [+]
hsa-mir-20a chr13: 92003319-92003389 [+]
hsa-mir-19b-1 chr13: 92003446-92003532 [+]
hsa-mir-92a-1 chr13: 92003568-92003645 [+]
Database links

Mature sequence hsa-miR-20a-5p

Accession MIMAT0000075
Previous IDs hsa-miR-20;hsa-miR-20a
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Deep sequencing 9847 reads, 46 experiments
Evidence experimental; cloned [1,4-7], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-20a-3p

Accession MIMAT0004493
Previous IDs hsa-miR-20a*
Sequence

44 - 

acugcauuaugagcacuuaaag

 - 65

Get sequence
Deep sequencing 82 reads, 13 experiments
Evidence experimental; cloned [6]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).