Stem-loop sequence mmu-mir-455

Accession MI0004679
Symbol MGI:Mir455
Description Mus musculus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
cucccu  u ug  c          u      a   c   aa 
      gg g  ag guaugugccu uggacu cau gug  c
      || |  || |||||||||| |||||| ||| |||  g
      cu c  uc cauauacggg accuga gua cac  c
-----a  c gu  a          c      c   c   ga 
Get sequence
Deep sequencing
41813 reads, 94 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 63256851-63256932 [+]
sense
OTTMUST00000054416 ; Col27a1-004; intron 7
OTTMUST00000000701 ; Col27a1-001; intron 10
OTTMUST00000054415 ; Col27a1-003; intron 10
OTTMUST00000000702 ; Col27a1-002; intron 10
ENSMUST00000156519 ; Col27a1-004; intron 7
ENSMUST00000036300 ; Col27a1-001; intron 10
ENSMUST00000148751 ; Col27a1-003; intron 10
ENSMUST00000125504 ; Col27a1-002; intron 10
Database links

Mature sequence mmu-miR-455-5p

Accession MIMAT0003485
Previous IDs mmu-miR-455;mmu-miR-455-5p;mmu-miR-455*
Sequence

17 - 

uaugugccuuuggacuacaucg

 - 38

Get sequence
Deep sequencing 5444 reads, 76 experiments
Evidence experimental; MPSS [1], miRAP-cloned [2], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-455-3p

Accession MIMAT0003742
Previous IDs mmu-miR-455-3p;mmu-miR-455
Sequence

54 - 

gcaguccacgggcauauacac

 - 74

Get sequence
Deep sequencing 14716 reads, 78 experiments
Evidence experimental; MPSS [1], miRAP-cloned [2], cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).