Stem-loop sequence mmu-mir-497

Accession MI0004636
Symbol MGI:Mir497
Description Mus musculus miR-497 stem-loop
Gene family MIPF0000231; mir-497
Stem-loop 
cc     c   c c    g    c         u  --   ac 
  ugccc cgc c agca caca ugugguuug ac  ggc  u
  ||||| ||| | |||| |||| ||||||||| ||  |||   
  auggg gcg g uugu gugu acaccaaac ug  ccg  g
--     a   a a    g    c         c  ca   gu
Get sequence
Deep sequencing
58168 reads, 93 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 70234717-70234800 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-497
mmu-mir-497 chr11: 70234717-70234800 [+]
mmu-mir-195a chr11: 70235042-70235135 [+]
Database links

Mature sequence mmu-miR-497-5p

Accession MIMAT0003453
Previous IDs mmu-miR-497
Sequence

14 -  

cagcagcacacugugguuugua

 - 35

Get sequence
Deep sequencing 51802 reads, 78 experiments
Evidence experimental; MPSS [1], cloned [2], Solexa [3,5]
Validated targets
Predicted targets

Mature sequence mmu-miR-497-3p

Accession MIMAT0017247
Previous IDs mmu-miR-497*
Sequence

54 -  

caaaccacacugugguguuag

 - 74

Get sequence
Deep sequencing 767 reads, 34 experiments
Evidence experimental; 454 [4], Solexa [5]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).