|
miRBase |
|
Stem-loop sequence hsa-mir-542 |
|||||
| Accession | MI0003686 | ||||
| Symbol | HGNC:MIR542 | ||||
| Description | Homo sapiens miR-542 stem-loop | ||||
| Gene family | MIPF0000185; mir-542 | ||||
| Stem-loop |
----------caga auc gg uca -a c ucucagac ucgg auca ugucacgag uac a |||||||| |||| |||| ||||||||| ||| agggucug aguc uagu acaguguuc gug g acuucuacucaccg gaa aa uag ac u |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-542-5p |
|
| Accession | MIMAT0003340 |
| Sequence |
16 - ucggggaucaucaugucacgaga - 38 |
| Deep sequencing | 30 reads, 7 experiments |
| Evidence | experimental; cloned [1-3] |
| Predicted targets |
|
Mature sequence hsa-miR-542-3p |
|
| Accession | MIMAT0003389 |
| Sequence |
53 - ugugacagauugauaacugaaa - 74 |
| Deep sequencing | 1371 reads, 23 experiments |
| Evidence | experimental; cloned [1-2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|