Stem-loop sequence hsa-mir-628

Accession MI0003642
Symbol HGNC:MIR628
Description Homo sapiens miR-628 stem-loop
Gene family MIPF0000529; mir-628
Stem-loop 
auagcugu  u   a      ca  -   a   a             aaaa 
        ug guc cuuccu  ug cug cau uuuacuagagggu    u
        || ||| ||||||  || ||| ||| |||||||||||||     
        ac cgg gaaggg  gc gac gug gaaugaucuucca    u
-------u  u   -      aa  u   g   a             auaa
Get sequence
Deep sequencing
138 reads, 20 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 55665138-55665232 [-]
sense
OTTHUMT00000419854 ; CCPG1-005; exon 1
OTTHUMT00000419854 ; CCPG1-005; exon 1
OTTHUMT00000419849 ; CCPG1-002; intron 5
OTTHUMT00000419850 ; CCPG1-001; intron 5
OTTHUMT00000419851 ; CCPG1-004; intron 5
OTTHUMT00000419855 ; CCPG1-003; intron 5
OTTHUMT00000419856 ; CCPG1-006; intron 5
OTTHUMT00000419857 ; CCPG1-008; intron 5
OTTHUMT00000419849 ; CCPG1-002; intron 5
OTTHUMT00000419850 ; CCPG1-001; intron 5
OTTHUMT00000419851 ; CCPG1-004; intron 5
OTTHUMT00000419855 ; CCPG1-003; intron 5
OTTHUMT00000419856 ; CCPG1-006; intron 5
OTTHUMT00000419857 ; CCPG1-008; intron 5
OTTHUMT00000420537 ; CCPG1-013; intron 6
OTTHUMT00000420537 ; CCPG1-013; intron 6
OTTHUMT00000419949 ; DYX1C1-CCPG1-001; intron 12
OTTHUMT00000419949 ; DYX1C1-CCPG1-001; intron 12
ENST00000568372 ; CCPG1-005; exon 1
ENST00000568372 ; CCPG1-005; exon 1
ENST00000442196 ; DYX1C1-206; intron 5
ENST00000425574 ; DYX1C1-205; intron 5
ENST00000310958 ; DYX1C1-201; intron 5
ENST00000442196 ; CCPG1-002; intron 5
ENST00000310958 ; CCPG1-001; intron 5
ENST00000425574 ; CCPG1-004; intron 5
ENST00000568808 ; CCPG1-003; intron 5
ENST00000569205 ; CCPG1-006; intron 5
ENST00000570272 ; CCPG1-008; intron 5
ENST00000442196 ; CCPG1-002; intron 5
ENST00000310958 ; CCPG1-001; intron 5
ENST00000425574 ; CCPG1-004; intron 5
ENST00000568808 ; CCPG1-003; intron 5
ENST00000569205 ; CCPG1-006; intron 5
ENST00000570272 ; CCPG1-008; intron 5
ENST00000563171 ; CCPG1-013; intron 6
ENST00000563171 ; CCPG1-013; intron 6
ENST00000565113 ; DYX1C1-CCPG1-001; intron 12
ENST00000565113 ; DYX1C1-CCPG1-001; intron 12
Database links

Mature sequence hsa-miR-628-5p

Accession MIMAT0004809
Sequence

23 -  

augcugacauauuuacuagagg

 - 44

Get sequence
Deep sequencing 133 reads, 17 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-628-3p

Accession MIMAT0003297
Previous IDs hsa-miR-628
Sequence

61 -  

ucuaguaagaguggcagucga

 - 81

Get sequence
Deep sequencing 4 reads, 3 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).