Stem-loop sequence rno-mir-224

AccessionMI0003483 (change log)
DescriptionRattus norvegicus miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

11 open access papers mention rno-mir-224
(82 sentences)

Stem-loop
          ca         u   u      a u   ug  uu 
5' gggcuuu  agucacuag ggu ccguuu g aga  gu  u
   |||||||  ||||||||| ||| |||||| | |||  ||   
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua  u
          ca         -   u      a -   gu  cg 
Get sequence
Deep sequencing
6728 reads, 0.538 reads per million, 372 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 152223754-152223835 [-]
sense
ENSRNOT00000022431 ; Gabre-201; intron 7
ENSRNOT00000039949 ; Gabre-202; intron 8
Database links

Mature sequence rno-miR-224-5p

Accession MIMAT0003119
Previous IDsrno-miR-224
Sequence

8 - 

caagucacuagugguuccguuu

 - 29

Get sequence
Deep sequencing6655 reads, 371 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-224-3p

Accession MIMAT0017200
Previous IDsrno-miR-224*
Sequence

55 - 

aaauggugcccuagugacuaca

 - 76

Get sequence
Deep sequencing73 reads, 54 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).