|
miRBase |
|
Stem-loop sequence hsa-mir-299 |
|||||
| Accession | MI0000744 | ||||
| Symbol | HGNC:MIR299 | ||||
| Description | Homo sapiens miR-299 stem-loop | ||||
| Gene family | MIPF0000186; mir-299 | ||||
| Stem-loop |
a uu aagaa ugguuuaccgucccacauacau u ||||| |||||||||||||||||||||| g uucuu gccaaaugguaggguguaugua a c ua |
||||
| Deep sequencing |
| ||||
| Comments |
The sequence from the 5' arm of this miRNA precursor is the predicted human homologue of mouse miR-299, cloned from mouse embryonic stem cells [1,2], later validated in human [4]. Altuvia et al [3] report the cloning of a miRNA sequence from the 3' arm of the same precursor in human. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-299-5p |
|
| Accession | MIMAT0002890 |
| Sequence |
7 - ugguuuaccgucccacauacau - 28 |
| Deep sequencing | 288 reads, 12 experiments |
| Evidence | experimental; cloned [4] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-299-3p |
|
| Accession | MIMAT0000687 |
| Previous IDs | hsa-miR-299;hsa-miR-299-5p |
| Sequence |
39 - uaugugggaugguaaaccgcuu - 60 |
| Deep sequencing | 51 reads, 2 experiments |
| Evidence | experimental; cloned [3-4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
| 2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
| 3 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|