Stem-loop sequence hsa-mir-518a-1

Accession MI0003170
Symbol HGNC:MIR518A1
Description Homo sapiens miR-518a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
             -  -            c      g  g c 
ucucaagcuguga cu gcaaagggaagc cuuucu uu u u
||||||||||||| || |||||||||||| |||||| || | g
agaguuuggcauu gg cguuucccuucg gaaaga aa a a
             a  u            c      g  g a 
Get sequence
Deep sequencing
16 reads, 7 experiments
Comments

The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 54234260-54234344 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-518a-1
hsa-mir-517b chr19: 54224330-54224396 [+]
hsa-mir-520g chr19: 54225420-54225509 [+]
hsa-mir-516b-2 chr19: 54228696-54228780 [+]
hsa-mir-526a-2 chr19: 54230176-54230240 [+]
hsa-mir-518e chr19: 54233092-54233179 [+]
hsa-mir-518a-1 chr19: 54234260-54234344 [+]
hsa-mir-518d chr19: 54238131-54238217 [+]
hsa-mir-516b-1 chr19: 54240099-54240188 [+]
hsa-mir-518a-2 chr19: 54242587-54242673 [+]
Database links

Mature sequence hsa-miR-518a-5p

Accession MIMAT0005457
Sequence

14 - 

cugcaaagggaagcccuuuc

 - 33

Get sequence
Deep sequencing 23 reads, 5 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-518a-3p

Accession MIMAT0002863
Previous IDs hsa-miR-518a
Sequence

51 - 

gaaagcgcuucccuuugcugga

 - 72

Get sequence
Deep sequencing 11 reads, 4 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).